Re: YP355 result is back

From: lvcooley5 <lvcooley5_at_cox.net>
Date: Sat, 14 Jun 2014 12:03:23 -0700

If I’m reading the chart correctly, YP355 seems to have emerged around 500 b.c. and S6842, also downstream from S5301, emerges around the same period. Are there any
ideas who or what S6842 represents? I mainly ask because the chart appears to imply that both S6842 and CTS4027 lead to the tribesman in red and yellow and my son Brian, who is showing a great interest in all of this, is going to ask me about them. I’m assuming that this group is currently unknown, like YP355, but unlike the group downstream from CTS4179 labeled Scots. I found the distribution map for CTS4027 indicating Sweden as the largest percentage, but haven’t found anything on S6842.

Jim

ps Thanks for taking the test!

From: Cooley
Sent: Friday, June 13, 2014 1:17 PM
To: John Cooley Mailing List
Subject: Re: YP355 result is back

That's great Michael that your positive for a SNP downstream from L448. When FTDNA offers testing of this SNP, I'll do the test to add more evidence that YP355 is indeed a Cooley Y-DNA SNP. -Don




On Fri, Jun 13, 2014 at 12:36 AM, Michael Cooley <michael_at_newsummer.com> wrote:

  I'm positive for it (meaning the call yielded "A"! YSEQ was a breeze to
  work with.

  --quote--
  YP355
  [YP355]
  HG19 Position: ChrY:15318528..15318528
  Ancestral: T
  Derived: A
  Reference: YFull (2014)
  ISOGG Haplogroup: R1a1a1b1a3a (not listed)
  Comments: Downstream of L448. parallel to CTS4179
  Forward Primer: YP355_F GCCTGGGATAAGACAGTTGC
  Reverse Primer: YP355_R TCGGATGTGTGCATTTTAGC
  --endquote--

  -Michael

  --
  <a href="http://newsummer.com/distlist">distlist 0.9b</a>
  See http://johncooley.net/list for list information.
Received on Sat Jun 14 2014 - 14:03:27 CDT

This archive was generated by hypermail 2.3.0 : Sat Jun 14 2014 - 14:04:04 CDT