He just turned 15 but he's been interested in the family tree for several
years. I try to explain the genetics the best that I can without confusing
both of us. He's really excited that
we descend from "Norsemen" and took it upon himself to learn Elder Futhark
and likes to translate modern words into ancient runes. I'm hoping he can
translate his interest into an
enjoyable career someday.
Jim
-----Original Message-----
From: Michael Cooley
Sent: Saturday, June 14, 2014 1:40 PM
To: John Cooley Mailing List
Subject: Re: YP355 result is back
Hi Jim,
The impression I have is that the evidence gathered for these SNPs are
presently minimal. I don't think an accurate timeline is known. And notice
that "Viking" no longer appears on this tree. It's all very fluid. Indeed,
the insertion of S5301 between Z284 and Z284 is recent.
I see that the timeline estimates are derived from the "K Nordtvedt
system." He's a physicist. I haven't had a chance to read this yet:
https://www.familytreedna.com/learn/news/ken-nordtvedt-genetic-genealogy-interview/
That's great to hear Brian is so interested! How old is he? Perhaps we
have a geneticist in the works! :)
-Michael
On Sat, June 14, 2014 3:03 pm, lvcooley5 wrote:
> This is a multi-part message in MIME format.
>
>
> ------=_NextPart_000_019F_01CF87C8.A47ABD70
> Content-Type: text/plain;
> charset="UTF-8" Content-Transfer-Encoding: quoted-printable
>
>
> If I=E2=80=99m reading the chart correctly, YP355 seems to have emerged =
> around 500 b.c. and S6842, also downstream from S5301, emerges around =
> the same period. Are there any ideas who or what S6842 represents? I
> mainly ask because the chart = appears to imply that both S6842 and
> CTS4027 lead to the tribesman in =
> red and yellow and my son Brian, who is showing a great interest in all =
> of this, is going to ask me about them. I=E2=80=99m assuming that =
> this group is currently unknown, like YP355, but unlike the group =
> downstream from CTS4179 labeled Scots. I found the distribution map for
> =
> CTS4027 indicating Sweden as the largest percentage, but haven=E2=80=99t =
> found anything on S6842. =20
>
> Jim
>
>
> ps Thanks for taking the test!
>
> From: Cooley=20
> Sent: Friday, June 13, 2014 1:17 PM
> To: John Cooley Mailing List=20
> Subject: Re: YP355 result is back
>
>
> That's great Michael that your positive for a SNP downstream from L448. =
> When FTDNA offers testing of this SNP, I'll do the test to add more =
> evidence that YP355 is indeed a Cooley Y-DNA SNP. -Don
>
>
>
>
> On Fri, Jun 13, 2014 at 12:36 AM, Michael Cooley <michael_at_newsummer.com>
> =
> wrote:
>
>
> I'm positive for it (meaning the call yielded "A"! YSEQ was a breeze =
> to work with.
>
> --quote--
> YP355
> [YP355]
> HG19 Position: ChrY:15318528..15318528
> Ancestral: T
> Derived: A
> Reference: YFull (2014)
> ISOGG Haplogroup: R1a1a1b1a3a (not listed)
> Comments: Downstream of L448. parallel to CTS4179
> Forward Primer: YP355_F GCCTGGGATAAGACAGTTGC
> Reverse Primer: YP355_R TCGGATGTGTGCATTTTAGC
> --endquote--
>
>
> -Michael
>
>
> --
> <a href=3D"http://newsummer.com/distlist">distlist 0.9b</a>
> See http://johncooley.net/list for list information.
>
>
>
> ------=_NextPart_000_019F_01CF87C8.A47ABD70
> Content-Type: text/html;
> charset="UTF-8" Content-Transfer-Encoding: quoted-printable
>
>
> <HTML><HEAD></HEAD>
> <BODY dir=3Dltr>
> <DIV dir=3Dltr>
> <DIV style=3D"FONT-SIZE: 12pt; FONT-FAMILY: 'Calibri'; COLOR: #000000">
> <DIV>If I=E2=80=99m reading the chart correctly, YP355 seems to have =
> emerged around 500=20 b.c. and S6842, also downstream from S5301, emerges
> around the same=20 period. Are there any</DIV> <DIV>ideas who or
> what
> S6842 represents? I mainly ask because the =
> chart=20 appears to imply that both S6842 and CTS4027 lead to the
> tribesman
> in = red and=20 yellow and my son Brian, who is showing a great interest
> in
> all of this, = is=20 going to ask me about them.
> I=E2=80=99m assuming that =
> this group is=20 currently unknown, like YP355, but unlike the group
> downstream from = CTS4179=20
> labeled Scots. I found the distribution map for CTS4027 indicating =
> Sweden=20
> as the largest percentage, but haven=E2=80=99t found anything on =
> S6842. </DIV>
> <DIV> </DIV>
> <DIV>Jim</DIV>
> <DIV> </DIV>
> <DIV>ps Thanks for taking the test!</DIV>
> <DIV=20
> style=3D'FONT-SIZE: small; TEXT-DECORATION: none; FONT-FAMILY: =
> "Calibri"; FONT-WEIGHT: normal; COLOR: #000000; FONT-STYLE: normal; =
> DISPLAY: inline'>
> <DIV style=3D"FONT: 10pt tahoma">
> <DIV> </DIV>
> <DIV style=3D"BACKGROUND: #f5f5f5">
> <DIV style=3D"font-color: black"><B>From:</B> <A =
> title=3Dcool.hg.r1a_at_gmail.com=20
> href=3D"mailto:cool.hg.r1a_at_gmail.com">Cooley</A> </DIV>
> <DIV><B>Sent:</B> Friday, June 13, 2014 1:17 PM</DIV>
> <DIV><B>To:</B> <A title=3Dundisclosed.recipients_at_johncooley.net=20
> href=3D"mailto:undisclosed.recipients_at_johncooley.net">John Cooley =
> Mailing List</A>=20
> </DIV>
> <DIV><B>Subject:</B> Re: YP355 result is back</DIV></DIV></DIV>
> <DIV> </DIV></DIV>
> <DIV=20
> style=3D'FONT-SIZE: small; TEXT-DECORATION: none; FONT-FAMILY: =
> "Calibri"; FONT-WEIGHT: normal; COLOR: #000000; FONT-STYLE: normal; =
> DISPLAY: inline'>
> <DIV dir=3Dltr>That's great Michael that your positive for a SNP =
> downstream from=20 L448. When FTDNA offers testing of this SNP, I'll do
> the
> test to add = more=20 evidence that YP355 is indeed a Cooley Y-DNA SNP.
> -Don<BR></DIV>
> <DIV class=3Dgmail_extra><BR><BR>
> <DIV class=3Dgmail_quote>On Fri, Jun 13, 2014 at 12:36 AM, Michael =
> Cooley <SPAN=20
> dir=3Dltr><<A href=3D"mailto:michael_at_newsummer.com"=20
> target=3D_blank>michael_at_newsummer.com</A>></SPAN> wrote:<BR>
> <BLOCKQUOTE class=3Dgmail_quote=20
> style=3D"PADDING-LEFT: 1ex; MARGIN: 0px 0px 0px 0.8ex; BORDER-LEFT: #ccc =
> 1px solid">I'm=20
> positive for it (meaning the call yielded "A"! YSEQ was a breeze =
> to<BR>work=20 with.<BR><BR>--quote--<BR>YP355<BR>[YP355]<BR>HG19
> Position:=20
> ChrY:15318528..15318528<BR>Ancestral: T<BR>Derived: A<BR>Reference: =
> YFull=20
> (2014)<BR>ISOGG Haplogroup: R1a1a1b1a3a (not listed)<BR>Comments: =
> Downstream=20
> of L448. parallel to CTS4179<BR>Forward Primer: YP355_F=20
> GCCTGGGATAAGACAGTTGC<BR>Reverse Primer: YP355_R=20
> =
> TCGGATGTGTGCATTTTAGC<BR>--endquote--<BR><BR>-Michael<BR><BR>--<BR><a=20
> href=3D"<A href=3D"http://newsummer.com/distlist"=20
> target=3D_blank>http://newsummer.com/distlist</A>">distlist=20
> 0.9b</a><BR>See <A href=3D"http://johncooley.net/list"=20
> target=3D_blank>http://johncooley.net/list</A> for list=20
> information.<BR></BLOCKQUOTE></DIV>
> <DIV> </DIV></DIV></DIV></DIV></DIV></BODY></HTML>
>
>
> ------=_NextPart_000_019F_01CF87C8.A47ABD70--
>
>
> --
> <a href="http://newsummer.com/distlist">distlist 0.9b</a>
> See http://johncooley.net/list for list information.
>
>
--
VP, the Cooley Family Association of America
Administrator, the Akins DNA Project
Administrator, the Ashenhurst DNA Project
Administrator, the Bishop DNA Project
Administrator, the Eldridge DNA Project
Administrator, the Fisk DNA Project
Administrator, the alt-McDowell DNA Project
Co-Administrator, the Cooley DNA Project
Co-Administrator, the McDougall DNA Project
Co-Administrator, the Pickens DNA Project
Co-Administrator, the Strother DNA Project
Instructor, the Osher Lifelong Learning Institute (OLLI)
B.A. Humboldt State University, History
--
<a href="http://newsummer.com/distlist">distlist 0.9b</a>
See http://johncooley.net/list for list information.
Received on Sat Jun 14 2014 - 22:16:10 CDT